BRAIDGROUP
RESEARCH & DEV

The End of
Probabilistic AI.

A deterministic cognitive architecture that proves rather than guesses. Built from first principles on symbolic reasoning, purpose-built for hallucination-free enterprise inference.

Scroll
DeterministicInferenceSame input, same output
14-LayerArchitectureCognitive pipeline
5TargetsBrowser to bare metal
206ModulesNative standard library

Designed for Absolute Truth.

Legacy models hallucinate because they lack structural grounding in reality. Braid replaces probabilistic guesswork with a deterministic architecture. Every logical constraint is verified against an immutable foundation of axioms before the engine accepts it as truth.

◇

Graph, Not Weights

Knowledge is stored as explicit nodes and edges in a dialectical tree with auditable proof chains — not as billions of implicit float parameters.

∞

Converges, Not Generates

The engine cascades to a fixed point — it knows when it's done. No token budget, no arbitrary cutoff. Resolution, not generation.

⊧

Proves, Not Guesses

Every reasoning step produces a proof trace with axiom checks and synthesis history. When the engine doesn't know, it says so.

⚠

Safety by Construction

The Overseer enforces immutable Foundation axioms on every reasoning step. Harmful concepts are rejected before they can propagate.

Core Architecture

Three Pillars of the Cognitive Engine.

The Language

Braid: From Browser to Bare Metal.

A systems language with Python-like syntax, five compilation targets, type inference, a polyhedral optimizer, inline native assembly, first-class tensors with autograd, and a formal logic algebra. Written in pure C.

WebAssembly
Binary .wasm output
Bytecode VM
96 opcodes, stack-based
x86_64 JIT
Direct machine code
LLVM IR
Native compilation
Inline Assembly
Raw bytes in source
Diameter Reasoning

A first-class language construct for dialectical reasoning. Nodes carry two opposing poles that resolve through tension — built into the compiler, parser, and VM.

First-Class Tensors

Native tensor operations with automatic differentiation. Declarative model definitions, device transfer, and a full training loop — all in the language itself.

Algebraic Effects

Effect declarations with handlers and delimited continuations. A principled approach to side effects inspired by OCaml 5 and Koka.

Compile-Time Execution

Comptime blocks evaluated at build time. Runtime self-modification — programs that write and compile new code dynamically.

System Architecture

Full-Stack Deterministic Platform.

From source code to native execution, every layer is designed for mathematical certainty.

SOURCE CODE.br / .bx filesBRAIDC COMPILERLexer → Parser → Type Checker→ IR → CodegenC/C++ pipelineNATIVE EXECUTABLEgcc → binaryBYTECODE VM.bx → BraidVMDTS ENGINE495 CVEs, 24 layersDIAMETER LOGICThesis ↔ Antithesis→ SynthesisDialectical reasoningML PIPELINETensor Ops / AutogradNeural Network LayersModel Training API151K vocab, 30s inferenceAPPLICATION LAYERFrontend (Bond/Blend/Link) • Junction (Full-Stack) • Braid Cloud • Fusion Ecosystem
Platform

Explore the Stack.

Capabilities

Built for Enterprise Scale.

Execution Strategy

The Braid Roadmap.

✓

The Engine

Building

14-layer inference pipeline with dialectical synthesis, foundation axioms, and safety enforcement. The core cognitive architecture is operational.

⚙

The Language

Building

A systems language with five compilation targets, type inference, and a polyhedral optimizer. Four backends operational, WebAssembly in progress.

◇

The OS

Designing

A deterministic operating environment with a microkernel, unikernel isolation, and the cognitive engine as the systems manager.

Research Initiative

The Helix Initiative.

Applying deterministic cognitive architecture to biological modeling — mapping and compressing genomic data using graph-based reasoning. The same architecture that reasons about logic can model cellular structures and genetic sequences as distinction trees.

CGATCGTAGCTAGCTGATCGATGCTAGCTAGGCTAGCTGATCGTAGCTAGCTGATCGATGCTATCGATGCTAGCTAGCGATCGTAGCTAGCTGTAGCTAGCTGATCGATGCTAGCTAGCGATCGCGATCGTAGCTAGCTGATCGATGCTAGCTAG
GENOMIC MODELING

Enterprise Scale.

The Braid cognitive engine powers Distinction Labs, which owns Trulay (formerly SMSLYCLOUD) and the Fusion Ecosystem.